Embedded Files
miRNA let-7b inhibitors by treatment of diabetic retinopathy: evaluation patent US2019093106
miRNA let-7b inhibitors by treatment of diabetic retinopathy: evaluation patent US2019093106
Martín Pérez-Santos* iD
Dirección de Innovación y Transferencia de Conocimiento, Benemérita Universidad Autónoma de Puebla, Ciudad Universitaria, San Manuel, Puebla, México. C. P. 72570. *martin.perez@correo.buap.mx
http://doi.org/10.5281/zenodo.5093717
Bajar cita (RIS): Pérez-Santos 2020 AyTBUAP 5(18): 1-7
Editado por: Jesús Muñoz-Rojas (Instituto de Ciencias, Benemérita Universidad Autónoma de Puebla)
Fecha de Publicación: 21 de mayo de 2020
EOI: https://eoi.citefactor.org/10.11235/BUAP.05.18.01
URI: https://hdl.handle.net/20.500.12371/9407
Referencia: Pérez-Santos M. miRNA let-7b inhibitors by treatment of diabetic retinopathy: evaluation patent US2019093106. Alianzas y Tendencias BUAP [Internet]. 2020;5(18):1–7. Available from: https://www.aytbuap.mx/publicaciones#h.n833pt4qitm3
ABSTRACT
Introduction: diabetic retinopathy is a clinical complication that affects to a 93 million people suffering from diabetes and is responsible for more hospitalizations than any other complication of diabetes. Authors of US2019093106 patent propose a method for treatment of diabetic retinopathy. Areas covered: US2019093106 describes a method that consists of the administration of inhibitor of miRNA let-7b, in patients with diabetic retinopathy; additionally describe a method to inhibiting the effects of increased levels or activity of miRNA let-7b. Expert opinion: The results pre-clinical trials support the therapy’s efficacy; however, the invention is not new considering art state, whereby, new studies will be necessary to determine other administration routes, e.g. topical, dose and time of administration.
Keywords: miRNA let-7b; diabetic retinopathy; patent; diabetes; inhibitor.
INTRODUCTION
Globally, diabetes mellitus has been recognized as the third cause of premature mortality due to hyperglycemia. The data suggests that about 415 million people live with diabetes, of which 75% live in low- and middle-income countries [1]. Similarly, it is estimated that by 2040 there will be 642 million people with diabetes [2]. Various clinical complications are observed in patients with type 2 diabetes mellitus, including cardiovascular disease, diabetic foot ulcer, retinopathy, neuropathy and nephropathy [3; 4; 5; 6; 7]. According to Yau et al., diabetic retinopathy affects to 93 million people suffering from diabetes [8]. Similarly, Leasher et al. has shown that diabetic retinopathy was responsible for the visual impairment of 3.7 million people and the blindness of 0.8 million people [9]. Diabetic retinopathy is a progressive disease that, according to its severity, is divided into non- proliferative and proliferative. The first is characterized by micro-aneurysms and intraretinal microvascular anomalies, while the second is characterized by neovascularization of the optic disc and preretinal and vitreous hemorrhage [10]. There are several treatment modalities for diabetic retinopathy, which include the topical application of growth factors, synthetic drugs and natural products. For example, calcium dobesilate inhibits apoptosis of vascular endothelial cells in blood vessels and the expression of ICAM-1 [11; 12; 13]. Similarly, Aflibercept is a recombinant fusion protein from promotions of extracellular domains of VEGF receptors 1 and 2 fused to the Fc portion of IgG [14; 15]. In turn, Ranibizumab is a fragment of a monoclonal antibody that does not contain the Fc region and with affinity for VEGF- A [16; 17]. On the other hand, several synthetic drugs such as triamcinolone acetonide, dexamethasone or fluocinolone acetonide have been employed in the treatment of diabetic retinopathy [18; 19; 20; 21].
Continuous development of new alternatives for the treatment of diabetic retinopathy is necessary, and consequently this article evaluates the US2019093106 patent application [22], which describes the application of miRNA let-7b inhibitors as an alternative for healing diabetic retinopathy. miRNA let-7b, a microRNA that regulates cell proliferation and mediates immune responses [23], play a role in the pathogenesis of type 2 diabetes mellitus [24], and represents a potential target for the treatment of renal fibrosis in diabetic nephropathy [25] These inhibitors are owned by Novo Nordisk and patent applications were filed at the Patent Cooperation Treaty (WO2017062659), Europe (EP3359553) and the United States (US2019093106).
Chemistry and Biology
US2019093106 patent was published on March 28, 2019. Patent application claims and describes two methods. First method includes the administration of an inhibitor of miRNA let-7b to a patient with retinopathy (claims 1-23, 27). Second method includes the administration of a miRNA let-7b to a patient for inhibits the effects of increased levels or activity of miRNA let-7b associated with any injury, disease, or disorder (23-26). Further claims cover type inhibitors, route of administration, and their applications in diabetic retinopathy (Table I).
Key inhibitors of the invention are those having the nucleotide sequences SEQ ID 1 (AACCACACAACCUACUACCUCA) and SEQ ID 2 (AACCACACAACCUA). Those specific claims for said inhibitors (circles and filled cells) are observed in Table 1. In particular, the SEQ ID 1 inhibitor can be modified, in one or more nucleotides, through 2‘-O-methylating, 2‘-O- methoxyethylating, phosphorothioate linkages, cholesterol hydroxyprolinol linkage, or locked nucleic acid.
From the results of biological experiments, in a murine model of diabetic retinopathy, it can be concluded that the injection of a let-7b microRNA inhibitor reduces retinal capillary dropout, decreases microvascular leakage and prevents hyperproliferation of microvascular cells. Was observed that miRNA let-7b expression is upregulated in the retina during diabetic retinopathy of Akimba mouse model. This miRNA let-7b over-expression induced autophagy and accelerate the diabetic retinal degeneration, by directly targeting and downregulating the genes upstream of mTORC1 and FoxO3A pathway.
In another series of experiments, the authors determined the potential of miRNA let-7b inhibitors to protect or restore large-scale loss of retinal vessels and aberrant neovascularization. The sequence of the inhibitors used are described in Table II. When intravitreally injected in male mice, the antagomiR let-7b inhibitor conjugated with Dy-547 showed that it was located uniformly, from 8 weeks to 6 months, throughout the entire retinal vasculature. Additionally, treatment with the inhibitor reduced the ratio between the fall and the total retinal area by 24%; also, a protection of the thickness of the retina and the cellularity was observed.
Table I. Claims of US2019093106
Table I. Claims of US2019093106
Table II. MiRNA let-7b inhibitors
Table II. MiRNA let-7b inhibitors
m” indicates 2-O-Methyl moiety; * indicates Phosphorothioate and a cholesterol molecule at the 3‘; Dy-547 is a fluorescent molecule for detection; “l” indicates LNA modification; (3‘-Chl) is a cholesterol molecule at the 3‘; “l” indicates LNA modification; “me” indicates 2‘-O-methoxyethyl modification.
Expert opinion
US2019093106 patent describes the potential application of inhibitors of miRNA let-7b for the treatment of diabetic retinopathy. As mentioned in the Biology section, the inventors do show data regarding the efficacy of miRNA let7-b's treatment. Therefore, the patent is shown scientific data concerning effect on the protection of the thickness of the retina. Authors have not yet reported their results in scientific publications, nor have clinical trials started on such inhibitors. However, despite these positive premises, data supporting the invention are still limited; further studies aimed at investigating dose-response relationship, long-term effects, are indeed necessary to assess the clinical applicability of the invention.
Various claims of the patent appear not to be involved inventive step. For example, [26] describe the use of nucleic acids modified through 2‘-O-methylating, 2‘-O-methoxyethylating, phosphorothioate linkages, cholesterol hydroxyprolinol linkage, or locked nucleic acid, in such a way that the claims 1-7 , 8, 9, 11, 12 and 15 are preceded by Shen's work. However, Shen does not describe a sequence comprising SEQ ID 1 or SEQ ID 2 or a biologically active homolog or fragment of US2019093106. Similarly, [27] shown nucleic acids inhibitors of miRNA let-7b to treat or prevent cardiovascular diseases, anticipates claims 12, 14 and 15. These nucleic acids can be modified through 2‘-O-methylating, 2‘-O-methoxyethylating, phosphorothioate linkages, cholesterol hydroxyprolinol linkage, or locked nucleic acid. Particularly, said nucleic acid comprise SEQ ID 1 or a biologically active homolog or fragment of the US2019093106 invention. Likewise, Sallustio et al. [28] describes a new method for the diagnosis of glomerulonephritis which includes the use of antisense miRNAs. These nucleic acids show 100% sequence identity with SEQ ID 1 of US2019093106 patent, whereby claims 4-9 and 12-16 lack an inventive step. Although the patents described do not describe the application in the treatment of diabetic retinopathy with the miRNA let-7b inhibitors, SEQ ID and SEQ 2, the US2019093106’s applicant claims the invention very broadly. This invention only demonstrates its novelty in the case of sequences SEQ 1 and SEQ 2.
In conclusion, the application of inhibitors of miRNA let-7b for the treatment of diabetic retinopathy is not new or has inventive activity. Also, additional studies are necessary that include other types of additives that allow a greater permanence of the drug in the damaged tissue. Similarly, new studies will be necessary to determine, at the topical level, the dose and time of administration of inhibitors of miRNA let-7b.
ACKNOWLEDGMENTS
We thank the Mexican people for the support, through their taxes, provided for the development of this article.
FUNDING
The authors did not receive any financial support for the preparation of this manuscript
DECLARATION OF INTEREST
The authors have no relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.
REFERENCES
ISSN: 2594-0627
ISSN: 2594-0627
Page updated
Google Sites
Report abuse